129809647308648750_658Overview of PCR technology was developed mid 80 's in vitro nucleic acid amplification technology.
Instrument-specific, sensitive, high yield, fast, simple, repetitive, and easy the big advantage of automation. PCR techniques earliest United States Cetus company Kary Mullis of human genetic research center and colleagues in 1985 discovery and developmentGong; first application report is Saiki 1985, such as the application of PCR technology in the β-globin gene amplification and prenatal diagnosis of anemia sickle-shaped red blood cells. Then use the 1976 Chien, separation and thermal stability of Taq DNA polymerase, PCR greatly simplifies operation, and makes it possible to PCR automation 1987 KaRy Mullis wait for complete automation device, PCR technique for the practical stage. Started to develop thermostable polymerase from Fudan University in 1988, Professor Ma Liren, Academy of military medical sciences in 1989, developed the PCR device automatically, and continues to introduce new, recent development of PTC-51A/B-type DNA thermal cycle apparatusLittle, attractive, affordable, easy, and is particularly suitable for domestic applications. PCR 10 not invented, but has been used. Every year there are thousands of articles published. In 1991, the journal "PCR methods and applications" (PCr Methods and Application) in the United States founded to enable the scholarsHas its own forum for professional journals and reference.
PCR technique as a methodological revolution, is bound to greatly promote the molecular biological study of the subject, so that it reaches a new height. Announcement of the 1993 Nobel Prize in chemistry will be on October 13, Kary Mullis invented the "polymerase chain reaction" received this award. Now the worldAll use PCR to detect trace amounts of genetic material in the blood of patients, this achievement paved the way for an accurate diagnosis of AIDS and other diseases. Sweden's Royal Academy of Sciences said: "PCR methods have been widely used in biomedicine. The method combined with DNA sequencing is likely to become an innovative tool to study plant and animal taxonomy. "A Canada nationality United KingdomScientist Michael Smith for creating the "oligonucleotide gene site-directed mutagenesis" and Mullis shared the wing. The principle of PCR is a specific DNA fragment in vitro enzymatic synthesis of new methods, main denatured by the high temperature, low temperature annealing by polymerase chain reaction and temperature extends three steps repeated thermal cycles constitutes: in high temperature (95 ° c)Xia, to spread increased of target DNA double chain heated degeneration became two section single chain DNA template; then in low temperature (37~55℃) situation Xia, two section artificial synthesis of oligo nucleotide introduction real and complementary of single chain DNA template combination, formed part double chain; in Taq enzyme of most suitable temperature (72 ℃) Xia, to introduction real 3 ' end for synthesis of starting point, to single nucleotide for raw materials, along die5 ' → 3 ' directions, new DNA chain synthesis. In this way, each double-stranded DNA template, one solution for chain, annealing and extension of three steps after heat cycle is a two double-stranded DNA molecule. So again, the DNA of every cycle can become a template for the next cycle, each cycle are two synthetic primer DNCopy number amplification 1 time in a specific area, and 2n of PCR product batch number form of rapid expansion, after 25~30 a loop, in theory the gene amplification more than 109 times, in fact, usually ranging from 106~107 times. DNA is composed of four bases according to the principle of complementary pairs (adenine to thymine, t, c, cytosine guanine g) consisting of spiralDouble chain. Within the cell, DNA replication, helicase first undo the double chain make it into a single strand as a template, and then, other enzymes--RNA polymerase synthesis a short primer (Primer) binding to the DNA template, and finally, DNA synthesis enzymes in this primer as a starting point, new chain synthesis and DNA template matching. PCR is the in vitro simulation of DNA copy of the process, its approach to the study of DNA fragments of heated denatured into two single-chain, synthesized two primers to let them into the ends of the DNA template, DNA polymerase can be a large number of copies of the template. Assuming the amplification efficiency "x" numbers, "n", multiples and amplification of the two "y" formula can be expressed as: y = (1 x)n。 Amplification 30 when a loop that is n=30, X=100%, y=230=1073741824 (109), when and if X=80%, then y=1.830=45517159.6 (107). Thus, the expansion of multiples was huge, the PCR products electrophoresis, ethidium bromide stain, UV stove lightShoot down (254nm) are generally visible to the specific amplification of DNA. Response system, a fundamental principle of PCR, PCR operation example (see diagram right): you want to join in a typical PCR reaction system: suitable buffer, trace the template DNA, polymerase chain reaction instrument 4xdNTPs, thermostable polymerase, Mg2 andTwo synthetic DNA primers. Template DNa 94 ° c denaturation 1min, primers and Templates extension 40~60℃ annealed 1min,72 ℃ 2min. Template denaturation 3~5min before the cycle for the first time; in the last cycle, must continue to extend the sample 3~5min above, ensure that the amplification of the DNA is double-stranded DNA. For ease of understanding PCRThe composition of the various components from reactions, additions and reaction conditions so that people on this basis, on different subjects of itemized changes to find the optimum reaction conditions, Perkin Elmer Gene Amp DNA Cetus company listed for reference kit provides a typical reaction conditions. Second, the PCR reaction system consisting of (a) PCR inhibitorsRed liquid (PCrBuffer) standard buffer to PCR PCR operation examples. At 72 ° c, pH value will drop 1 unit of the reaction system, close to 7.2. Presence of Divalent cations is crucial, affecting PCR specificity and yield.
Experiments show that Mg2 is superior to Mn2, Ca2 without any action. 1.Mg2 Mg2 's best concentration of 1.5mmol/L (when 200mmol/L is all dNTP concentration), but not to any one combination of primers and templates are the best. When you use a combination of target sequence and Primer for the first time, are to be transferred to the best concentration of Mg2, its areas of concentration for the 1~10mmol/L. Mg2Excessive non-specific amplification products, inadequate Mg2 yields lower. There is a high concentration in the samples with chelating agents such as EDTA or high concentrations of negatively charged Ionic groups such as phosphates, lower effective concentration of Mg2 will combine with Mg2. Therefore, as the template DNA is soluble in 10mmol/l Tris-HCl (pH7.6) 0.1mmol/L EDTA. DNTP containing phosphates, the changes will affect the effective concentration of Mg2. Standard 4xdTNPs the total concentration in the reaction system of 0.8mmol/L, down from 1.5mmol/L the concentration of Mg2. Therefore, when DNA in high concentrations and conditions of dNTP, mustAdjust the concentration of Mg2. 2. Tris-HCl buffer using the 10~50mmol/L of Tris-HCl buffer in PCR, rarely using other types of buffer. Tris buffer buffer is a dual-polarized ions, pKa is 8.3 (20 ° c), pKa is 0.0 polymerase chain reaction for 21/℃。
Therefore, 20mmol/l Tris pH8.3 (20 ° c), in a typical thermal cycling conditions, real pH values between 7.8~6.8. 3. KCl concentration k concentration in 50mmol/L can promote primer annealing. But studies have shown that when NaCl concentration in 50mmol/L, KCl concentration higher than50mmol/L will inhibit Taq enzyme activity, and little or no KCl in PCR result is not too much of an impact. 4. Gelatin gelatin and BSA or non-ionic detergents with stabilized enzyme function.
General dosage is 100 mu g/ml, but now research has shown that, with or without can be good and PCR results have little impact. 5. DimethylSulfoxide (DMSO) DMSO in PCR using the Klenow fragment is useful; the joined 10%DM-SO in favour of reducing the secondary structure of DNA, (g-c)% content template easy to completely denatured, joined in the reaction system of DMSO allow direct sequencing of PCR products easier, but will inhibit Taq 10% dNA polymerase activity, so most do not use DMSO. (B) four kinds of Deoxy-nucleotide triphosphate (4xdNTPs) in PCR dNTP concentrations above 50mmol/L in anti-system inhibits activity of the Taq enzyme, use low dNTP concentration to reduce non-target position and extend a nucleotide error when mixing, high concentrations of dNTPs easy to produce an error mixing, concentration is too low, is bound to reduce the yield of the reaction. Concentration of PCR for 50~200 Mu mol/L, cannot be less than 10~15 Mu mol/L. Four dNTP concentration should be the same concentration of either high or low, polymerase errors induced by mixed, reduce the speed of synthesis, premature termination reactions。 Factors which determine minimum dNTP concentration is the length and composition of the target DNA sequence, for example, 100 μ l in the reaction system, concentration 20 μ 4xdNTPs mol/L, meet the synthesis of 2.6 μ g 400bp sequences of DNA or 10pmol. 50 synthesis of 6.6 μ μ mol/L 4xdNTPs gDNA, 25 μ synthesis 200 μ mol/L enough to g/DNA. DNTP solution purchased from manufacturers generally do not adjust pH, 1mol/l NaOH dNTP storage of hydraulic adjust pH to 7, to ensure that the reaction of the pH value of not less than 7.1. Free nucleotides purchased in powder, dissolves to use both NaOH and UVSpectrophotometer quantitatively. (C) concentration of primers in PCR reactions usually between 0.1~1 Mu mol/L. Primer-Dimer concentration formation and non-specific products. In General with a low concentration of economic, special, but the concentration is too low, not enough to complete 30 cycles of amplification reaction, you will reduce the yield of PCR. (D)TaqDNA typical of the polymerase in the PCR reaction mixtures, using enzymes 2.5U/μ l, common range 1~4U/100 μ l.
Because of the DNA template and primers for different, and other conditions of the variance, polymerase differ, too much amount of enzyme can lead to increased non-specific products. Because manufacturers are using military forces formulasActivity definitions, manufacturing conditions are different, different manufacturers supply TaqDNA by polymerase chain reaction PCR performance varies. Cetus Corporation enzyme is defined as one of enzyme units refers to the following conditions, at 74 ° c, 30min 10nmmol dNTP mixture of acid-insoluble components of enzyme required. Determination of time for 10min, Translated with 30min into the content. Analysis of conditions for 25nmol/L TAPS (three amino-hydroxy-methyl-propane sulfonic acid sodium salt pH9.3.25 ℃), 50mmol/l KCl,2mmol/L MgCl2.1mmol/L beta-ME (mercaptoethanol) and dATP, dTTP, dGTP all 200mmol/L,dCTP for 100mmol/L (tags are not marked and Alpha -32P by mix), 12. μ g modified herring sperm DNA, final volume of 50 μ l. (E) single and double-stranded DNA or RNA template are available as samples for PCR. If the starting material is RNA, by reverse transcription is the first cDNA。 Although samples of PCR can be used only at very low levels, even the DNA from a single cell, but in order to ensure response specificity, NG level cloning of DNA are also applied, μ g horizontal single copies of chromosome DNA amplification fragment or 104 copy as a starting material, templates can be rough, but not mixed with any protein, nucleic acid enzyme, Taq DNA polymerAnd combined with DNA-protein synthase inhibitors. Size of the DNA is not the key factor, but when using very high molecular weight DNA (such as when the genomic DNA), such as ultrasonic treatment or lowering the rare restriction enzymes (such as Sal1 and Not1) Digest, amplification effect is better. Closed-round target sequences of DNA amplification efficiency is slightly lower than linear DNATherefore, using plasmid as reaction template of best first line. Template concentrations vary depending on the circumstances of the target sequence, often not controlled by the experimenter, experiment of known target sequences can be inverse way of reduction (1NG,0.1NG,0.001ng), set a set of controlled reaction to detect the sensitivity necessary to meet the requirements of the amplification reaction. (F) paraffin oil pCR expansion proposal when the mixture above spreading a layer of paraffin oil, reducing the liquid evaporates when especially during PCR denaturation caused by loss of product. Research shows that application allows the amplification of paraffin oil production increased 5 times, and maintain constant heat of paraffin oil and the salt concentration in the reaction system-related. Third, electrophoresis analysis in practice often used in agarose gel electrophoresis. AAs cases in liquid or gel electrophoresis buffer and 1% in ethidium bromide (EB) (per 100ml plus 100 μ l) and 1%~2% already preparing agarose gel (electric swimming buffer liquid) in electrophoresis tanks, joined the test sample to 10 μ l, both molecular weight standards for marking products. Agarose concentration of the separation of DNA fragments by sizeSelect the General 1.5%~2%, electrophoresis voltage 75V, samples from within the gel glue end 1cm, cut off the power supply, remove the condensation of polymerase chain reaction adhesives in direct observation under UV light. As ethidium bromide can be used with combination of double-stranded DNA formation, emitting fluorescent under ultraviolet light, fluorescence intensity enhancement of EB 80~100 times, therefore, electrophoresisGel under UV light after can be directly observed.
General naked eye observation of DNA of 10ng, with DNA fluorescence intensity is proportional to the content. DNA Molecular gel swimming speed decided to charge in effect and molecular effects. Determined by the net charge of the former, and the latter associated with molecular size and structure. According to the DNA molecule, the transfer can be done in different gel concentration ofThe whole. Laboratories may also be used with the necessary conditions of polyacrylamide gel electrophoresis (PAGE) analysis of amplified DNA fragments. Four main factors affecting the PCR, PCR techniques must synthesize a reasonable introduction and extraction of samples of DNA, and automatic thermal cycle, product identification and analysis of the final. Primer Design and synthesis is currently available in a limited number of technical forceStrong Research Institute, conducted clinical applications only need to buy PCR Detection Kit to work, automatic thermal cycle PCR many factors influence, different DNA samples, volume and temperature cycles of PCR reaction components by adding parameters are inconsistent.
Several main factors are described below. First, temperature cycles in parameter automatic thermal cycle PCR, The most critical factor is the denaturation and annealing temperature. As shown in the example operation, its denaturation, annealing and extension conditions are: 94 60s, 60s 37 ℃; 72 c 120s, all 25~30 a loop, 500bp amplification fragment. Here, every step should be removed from the reaction mixture after it reaches the required temperature is calculated. Automatic thermal cycleInstrument within by mixed liquid original temperature variable to by requirements temperature of time needs 30~60s, this a hysteresis time of length depends on several factors, including reaction tube type, and wall thick, and reaction mixed liquid volume, and heat source (water bath or heating block) and two steps between of temperature difference, in set hot cycle Shi should full given attention and considered, on each instrument are should for measured. Heat throughRing time of another key consideration is the distance between the two primers; farther, duration is the time required for the synthesis of target sequence is longer, earlier to the length of the response time is the most suitable for synthetic 500bp target sequence developed.
Introduction of various options for a temperature below. 1. Template denaturation temperature variability of temperature is the chain decided to double-stranded DNA in PCR reaction solution temperatureAnd reach the denaturation temperature does not produce single strand DNA template, PCR would not start. Degeneration of low denaturation temperature is incomplete, DNA double-strand complex soon, thus reducing yield. General preparation of 90~95℃. Sample once it reaches this temperature should be cool to the annealing temperature. DNA denaturation takes only a few seconds, long time no need; on the contrary, when the high temperatureShould be as short as possible, to maintain the activity of Taq DNA polymerase, highest after joining the Taq DNA polymerase denaturation temperature should not be more than 95 degrees centigrade. 2. Decided PCR specificity of primer annealing temperature annealing temperature yield; special high temperature and strong, but too high then the primers cannot combine with template solid, DNA amplification efficiency decreased yield high temperature low, but is too lowMay cause a mismatch of primers and templates, increase of non-specific products. Starting from 37 ° c reaction conditions, setting: a series of responses to determine the optimum annealing temperature of a particular reaction. Also according to the primer (g-c) speculated that% content, grasping the starting point of the experiment, annealing temperature than in the General test TTm low amplification primer melting temperature 5 ° c, according to the formulaCalculation: Ta=Tm-5 c =4 (c, g), 2 (a t) A,T,G,C-5 ℃ number represents the appropriate base. For example, 20 base primer, if (g-c) content is 50%%, starting point of the Ta can be set up to 55 degrees centigrade. In a typical concentration of primers (such as 0.2 μ mol/L),Annealing reaction a few seconds to complete, annealing is not necessary for a long time. 3. Choice of primer extension temperature depends on the optimum temperature of Taq DNA polymerase. Take 70~75℃, 72 ° c standard rates of up to 35~100 for enzyme catalytic nucleotide nucleotides/second. Extends length of 1kb per minute the speed depends on the buffer solution groupSalt, pH value, nature of the concentration and the DNA template. Amplified fragment such as shorter than 150bp, extension you can omit this step and becomes dual temperature cycling
Diablo 3 CD-KEY, Taq DNA polymerase synthesis of the annealing temperature is sufficient to complete the series. 100~300bp between short sequence fragments, fast and simple two-temperature cycle is very effective. At this point,Primer extension temperature and annealing temperatures are the same. 1kb DNA fragments above, based on the 1~7min fragment will extend the length of time, at the same time, PCR buffer required to join the BSA or gelatin reagent, the Taq DNA polymerase activity and stability of good in a long time; 15%~20% glycerol helps expansion of 2.5kb or long DNA fragments. 4. Loop routine PCR for 25~40 cycle. General error is circulating too many times, serious non-specific background, the complexity increases. Circular reaction times are too small
Rift Platinum, of course, the low production rate.
So, on the premise of guaranteed product yield, you should try to reduce cycle times. After the end of the expansion, sample cooling andBuy 4 c save. Second, primers PCR template DNA Primer Design, first to design two oligonucleotide primers, so-called primers, is actually a two-stage amplification of complementary target DNA sequence of the oligonucleotide fragments, decided the distance between the two primers amplified fragment length, two-primer 5 ' end deciding amplification products by two 5 ' end position. We can see that the primers are decidedPCR amplification fragment length, locations and results of critical, primer design is even more important. Primers and primer is necessary for the design of the complementary target DNA sequence must be known, between the two primer sequences may not be aware of, which a known sequence of 15~20 base, you can use the corresponding complementary DNA synthesis synthesizer with two primers, in addition,Primer Design general principles include: 1. Primer length is calculated according to the statistics, about 17 long oligonucleotide sequences of bases in the human genome that may occur by chance is 1. Therefore, minimum of not less than 16 nucleotides in length and the maximum of not more than 30 nucleotides, the best is 20~24 nucleotides in length. Such a short oligonucleotidePolymerization temperature (by 72) do not form a stable hybrid fit under. Sometimes in the 5 ' end add not complementary with the template sequence, such as restriction enzyme cutting sites, or launch factor, to complete the cloning and other special needs primer 5 ' end biotin or fluorescent markers can be used for microbiological testing and other purposes. Primer not working at times, reason unknown, removablePosition to resolve. 2. (G-c)% content of primers compositions should be even, Quito, avoiding as far as possible contain the same base polymer.
Two primers (g-c)% concentration should be as similar as possible, in the amplified fragment is known (g-c)% content up close to be amplified fragment, General 40%~60% is preferred. 3. Primers should be avoided within the significant secondary structure, Especially the hairpin structure (hairpinstructures). For example: 4. Between the primers should not occur between the two primers complementary, particularly in the Primer 3 '-end, if not avoided, the 3 '-end complementary bases should not be greater than 2 base, easy to generate "primer dimers" or "twice times" (Primer Dimer)。
So-called primer dimers are essentially under the action of DNA polymerase, a primer and the other one that is extended on the primer sequences formed by the introduction of a similar length and two double-stranded DNA fragment, is a common by-product of PCR, and sometimes even become the main product. In addition, avoidance of homologous sequences between the two primers, particularly for 6 more of the same base oligonucleotidesParagraph or introduction of competing templates of the same two sites; Similarly, primers and DNA amplification of target DNA or sample there cannot be more than 6 other sequences homologous sequences of bases.
Otherwise, the primer will combine with other sites, specific amplification reduced, increased non-specific amplification. 5. Primer 3 '-end matched DNA polymerase Primer 3 '-end add soloCamp, so the Primer 3 ' end 5~6 base pairing with the target DNA must be precise and strict requirements, so as to guarantee the effective amplification PCR.
Primer Design is reasonably available and PCRDESN software United States PRIMER to computer software to retrieve for approval. Synthetic oligonucleotide primers in the best after chromatography (computerized tomography), purification, or PAGEPurification to remove not synthesis to full length of short chain and other impurities.
Purification primer 25% 4 c save in acetonitrile solution prevents microbial growth; generally, unused primers should be kept at-20 ° c freezer, primers can be retained for 6 months in the liquid, freeze-dried to save for 1-2 years. Third, the DNA polymerase in 1956 KornbergFound from the extract of Escherichia coli DNA polymerase, and supported by DNA polymerase I pure product. DNA polymerase I is the molecular weight of a polypeptide chain structure of 109,000, this enzyme by Bacillus subtilis protease into two fragments, a fragment molecular weight of 76,000, polymerase activity, and there are 3 ' → 5 circumscribed enzymes, namely KlenoW clips (Klenow fragment). Another fragment molecular weight 34,000, with a 5 ' → ' 3 ' circumscribed activity. Therefore, DNA polymerase has several functions: one is an aggregate function, using DNA as a template, dNTP dNTP added one by one to the end of the 3-OH. Second, ' 3 ' → 5 ' circumscribed enzymes,To identify and eliminate mismatches of end of the primer, and correction features in the replication process. Third, 5 ' → 3 ' activity circumscribed, it can from the 5 '-terminal nucleotide hydrolysis, but after several nucleotide work, removal of mismatched nucleotides. 1985 Mullis invented the PCR method, after completing the β-globin PCR the Klenow fragment, worldMany laboratories will consider the Klenow fragment is replaced by thermostable DNA polymerase PCR, enables rapid development of the study on thermostable polymerase. People live in 60 degrees Centigrade (B.Stearothermophilus) to 87 ° c (S.Solfatavicus) many of the separation and purification of a heat-resistant DNA polymerase in bacteria,But intolerant of some enzymes required for DNA denaturation temperature and so cannot be used in PCR. 1. Taq DNA polymerase for Taq DNA polymerase instead of Klenow fragment of Escherichia coli DNA polymerase I is the key to PCR and universal application. Klenow fragment cannot withstand the double-stranded DNA denaturation temperature of 95 ° c, so each loopTo join the new enzyme and Taq DNA polymerase can withstand high temperature of 93~95℃, avoiding the constant additional cumbersome operation of the polymerase, and allows the temperature of annealing and extension to improve, reducing non-specific products for PCR and DNA secondary structure of interference, yield and increase PCR specificity, sensitivity, compared to the two, the main difference is that: ① kOptimum temperature of 37 ° c lenow enzymes, not all of the products of the amplification is a sequence of objectives, one with a probe. Taq enzyme not only high yield and high specificity. It's optimal temperature for 74~75℃. Annealing temperature increases, the annealing of strictly increasing, reducing mismatch primer extension. ② low cycle enzymes in the late and have a flat slope. Reaches flat glassNumber of cycles, Klenow enzyme for 20 (1 μ g starting genomic DNA) and Taq enzyme is 30.
③ extension fragment length Taq enzyme 10kb, Klenow enzyme for 400bp. Taq enzyme by aquatic bacteria at high temperature (Thermusaquatics) YT1 comb isolated strains. This bacteria inIn 1969 by Brock separated from United States Yellowstone hot springs, as standard strains of Lactobacillus Habitat heat, its temperature is 70~75℃. Originally from isolation to a molecular weight of 60~68KDa, 2000~8000U/mg than the activity of DNA polymerase. Later, Kary Mullis, and separation of the Cetus Corporation to a specific activity200,000 U/mg of pure enzyme and molecular weight of 93,910. This enzyme's optimal temperature for 75~80℃ 9.4KDa, and single nucleotide binding rate (Kcat) up to 150 nucleotides (NT)/s enzyme molecules. M13 templates, rich in g c 30bp primer extension, 70 ?? Kact60nt/s;55 ?? whenTo 24nt/s;37 when 1.5NT/s
TERA Gold, and 22 ° c to 0.25nt/s.
Poor above 90 ° c DNA synthesis, and this under the conditions of high temperature, primer and the template is not a solid combination. In the PCR reaction mixture, Taq enzyme in 92.5 ° c, 95 ° c and 97.5 ° c to maintain its activity of 50% time130, 40 and 5~6min, 50 in the PCR cycle when the maximum temperature of 95 ° c inside the tube. Per cycle for 20s fashion keeps the 65% activity.
Taq enzyme has a half life of 40min in 95 ℃, the PCR denaturation temperature of the cycle selection, should not be higher than 95 ° c. Taq enzyme have been available recombinant DNA methods of production, commodityAmpli Taq (Cetus). Taq enzyme genes full length 2499bp, expressed in Escherichia coli, 832-containing amino acids.
On the amino acid sequence is consistent with 38% Escherichia coli DNA polymerase I, including with dNTP, primer and the template exists in the Taq enzyme. Taq enzymeHas rely on DNA synthesis of 5 ' → ' 3 ' circumscribed enzyme activity, so, template Shang has a annealing of 3 '-phosphate of of "blocking real", will is individually resection and does not block from upstream introduction real chain of extends, and for 5 ' -32P mark of synthesis oligo nucleotide introduction real, is regardless of is single chain or and template complex sexual, are is not found degradation, so the species activity does not effectPCR results. Taq enzyme No 3 ' → ' 5 ' circumscribed enzyme, dNTP error occurs if mixed, this enzyme no correction power, thus using the Taq enzyme for PCR, point mutations, and not too favourable to clone. General error rate of 1.25x10-4~1x10-5-doped (4xdNTPs concentration was 200 μ MoL/L,Mg2 1.5mmol/L, 55 ° c annealing).
But without 3 ' → 5 ' circumscribed enzymes good for sequencing. 2. Factors that affect enzyme activity of the Taq enzyme activity under the influence of ions Mg2. Herring sperm DNA as a template, the total dNTP concentration 0.7~0.8mmol/L,Mg2 2.0mmol/LAbility to activate when the highest. Concentrations exceeding this value inhibits. 10mmol/l MgCl2 inhibitory activity of 40%~50%. DNTP can combine with Mg2, so the amount remaining after the combination of free Mg2. When the total dNTP concentrations as high as 4~6mmol/L, Taq enzyme activity to reduce the 20~30%, that of substrate inhibition.DNTP concentrations of low yield and specificity of PCR are increased, suitable for amplified mixed by Mark biotin and radioactive elements.
When containing 100 μ l PCR-liquid dNTP 40 μ synthesis when the mol/L is enough to 2.6 μ g DNA (dNTP consume half). Herring sperm DNA,70 ℃, dNTP mixture in 10minCalculate, standard conditions of 100%. Pure 9.4KDa Taq enzyme without 3 ' → 5 ' exonuclease activity. Added by mistake rate depends on the concentration of dNTP. Chain shift of the Taq enzyme have a DNA-dependent 5 ' → 3 ' exonuclease activity. The 5 ' → 3 ' 32P labeled oligonucleotide chain, hybrid or MB template is little degradation when。
Medium concentration of KCl can stimulate synthesis of Taq enzyme activity of 50%~60%, 50mmol/L best KCl concentration, concentration higher inhibition, KCl makes the enzyme inactivation of 200mmol/L.
Add 50mmol/L or NH4Ac or NH4Cl NaCl, can produce a moderate inhibitory role or not. Low concentrationUrea, DMSO, DMF and formamide has little effect on TWAIN 20/NP40 eliminates the SDS (and 0.01%) inhibition. 3. Second generation of heat-resistant DNA polymerase Stoffel fragment: Cetus Corporation Stoffel TaqDNA polymerase's 5 ' → 3 ' circumscribed active fragment (n-end 289 amino acid) to remove, known as stoffel fragment.
Its half-life of 97.5 degrees centigrade from 5~6min up to 20min of Taq DNA polymerase, the enzyme fragment on two or more templates at the combined PCR amplification reaction (Multiplex PCR) is desirable. VentTMDNA polymerase:Is the United States from New England Biolabs company submarine vents (Vent) separated from hyper-thermophilic bacteria can grow to 98 degrees centigrade in the isolation and purification of Thermococcus litoralis to be, thus come the name Vent enzyme. Some of its properties more superior than Taq DNA polymerase, whichMore than 100 ℃ high temperature and 2H is still alive, and has the 3 ' → 5 ' circumscribed enzyme activity of correction capabilities, error amplification than the Taq enzyme reduces chance of 1 time. Later, the company went from deep water submarines (2010m) 104 ° c vent separation of GB-D strain Pyococcus bacteria on the growth of implanted Deep Vent DNA polymerizationDeep Vent and expression of DNA polymerase enzyme genes, at 95 ° c half-life of 23h (Vent to 6.7h,Taq enzymes of 1h). 4. RTth reverse transcriptase (rTth Reverse Transcriptase) now RT-PCR (RT-PCR) is developing rapidly,A heat-resistant RNA-dependent DNA polymerase's research and development. Experiments have shown that Taq DNA polymerase RNA-dependent DNA polymerase activity, but weaker activity. Cetus in 1991, the company launched a rTth Reverse Tran-scriptase, good RNA-dependentHeat-resistant DNA polymerase activity and relies on heat-resistant DNA polymerase activity of DNA, two kinds of activity dependent Mn2 respectively, so that you can each control activity.
The enzyme can be effective only 250ng total RNA by RT-PCR, get specific DNA fragment, which is conducive to the development of the RT-PCR. Heat-resistantStudy of DNA polymerase are considerable development, which has played an important role in the development of PCR.
Believe that with further research, heat-resistant DNA polymerase will make it to the understanding and application of further development. PCR research is developing rapidly in China, the key reagent-heat-resistant DNA polymerase purification-also has several laboratories, such as Fudan UniversityInstitute of genetics, magnificent company basic medical research Institute, Chinese Academy of medical sciences. Of the latter two strains of Thermus aquaticus YT-1. Screening of the former is out of their isolation and purification of thermophilic bacteria, genetics of Fudan University has also succeeded in cloning the polymerase gene and get heat-resistant F4DNA polymerase, its characterization of non-Often close to Taq DNA polymerase, PCR provides a guarantee in China. Four factors affecting the PCR specificity, through such content. You can see that there are many factors that can affect the specificity of the PCR, we made a generalization here, for your reference: ① the rigour of the annealing step: increase the annealing temperature reduces the hybrid does not match, so as to improve theThe opposite sex. ② short annealing time reduction and extended time extension can reduce errors and error is thrown. ③ Primer-Dimer is the most common form of by-products, reduce the concentration of primers and enzymes can also reduce errors caused, especially of primer Dimer. ④ change MgCl2 (sometimes KCl) concentration improved specificity, which may be strict or directly to the Taq enzyme reactionUsed. ⑤ in the template if there is a secondary structure, such as the fragment to be amplified easily form a hairpin structure itself may include 7-4xdNTPs in the PCR mixture nitrogen-2 '-Deoxy-Guanosine-5 '-triphosphate (7-deaza-2 '-deoxyguanosine-5 '-trihosphate) (de7GTP)。
DGTP mixture ratio of 3:1 and de7GTP (150 μ mol/l de7GTP 50 μ mol/L dGTP) instead of 200 Mu mol/l dGTP, the resistance of non-specific products generate. Five, amplification amplification reactions can not be infinite, certain evidenceRing cycle no longer exponential amplification of fragments you want more gradually into the flat slope; loop into the slope, there is a template depends on the starting number of copies, and total synthesis of DNA. So-called flat slope that is later in the PCR cycle, when the synthetic product 0.3~1pmol, due to product packing, original index increased rates into smooth curves. BuildingPCR enters the flat slope of the reasons: consumption is complete, such as primers and dNTP Taq enzyme inactivation, these factors do not appear in the standard response. In addition, there are several possibilities: 1. Excess substrate for DNA synthesis than Taq enzyme in the reaction, reaction liquid containing 100 μ l 2.5Utaq enzymes and the DNA synthesis up to 1 μ g (3Nmol oligodeoxynucleotide), started to become excess at the end. Extension of the extended time or add the Taq enzyme can be overcome.
But not practical, for each next loop extension will extend 1 time and 1 time more times Taq enzyme, to continue exponential growth. 2. Non-specific amplification products by competition and is closely related to the above, you do not need the DNA fragmentsFragment and needs at the same time competitive polymerase, to overcome this is to enhance response specificity, no need to fragment not a lot of accumulation. 3. Annealed product of single-chain yourself when associating two single strand of DNA fragments in the annealing time in addition to Association and primers, free association, which would prevent the products increased. When the concentration reaches 10pmol/100 μ l of the product,This behavior can occur, subject to dilution being able to overcome. 4.
Denatured under the condition of high-concentration products and product solutions for chains do not completely, and the role of resistance-end product (of pyrophosphate, double-stranded DNA). All in all, the PCR conditions is varies with the system, there is no unified in the best conditions, General conditions for use before amplification, and then changing the parameters, you can achieveOptimized to obtain good specificity and yield. Application mode, merge Primer (DegeneratePrimer) PCR codon degeneracy, speculated that coding sequence of DNA is in the amino acid sequence is not precise, but can be designed as a primer on annexation, amplified all of nucleic acid sequences encoding known order. Merger when oligodeoxynucleotidesNucleotide sequence can vary, but the number of nucleotides should be the same. More mergers, stronger product specificity, design of primers should be possible mergers of small amino acids, and avoid Primer 3 ' end merger, mixed Primer for merger has been successfully used in unknown target amplification, cloning and sequence analysis of DNA. Has now been successfully cloned pigs, diabetes, uric acid oxidase geneClose peptide gene and liver virus genes in mammals and birds. Deoxidation of inosine (deoxyinosine;DI) primers for PCR, you can instead of encoding proteins of the mergers of several mergers codon base, DI-specific major by cDNA of concentration effect. Second, the nested primers (NestedPrimer) first used in PCRPrimers amplified 15~30 a loop, then the amplified DNA fragment set a second set of primers for amplification of 15~30 in a loop, this allows the amplification of sequences are amplified efficiently, and little expansion of secondary structure. Start primer cap method or Centricon30 (Amicon) molecular filter centrifuge, at the second set of primers to join introduced firstMatter. This method has been successfully used for analysis of the Chinese hamster ovary cell AS52 molecular mutations. GPT AS52 cells contain a single copy of the cell (guanine Phos-phribosytransferase) gene and homology in mammals. Nested primers PCR reduces non-specific annealing, thereby increasing the-Specific amplification, increased amplification efficiency.
On detection of microorganisms in environmental samples and single-copy gene amplification of the target DNA is very effective. If the inside and outside of the nested-PCR primers with a little change and extension of drainage length (to 25~30bp), with reduced length of primers (15~17bp), introduced the first dual temperature cycle at high temperature annealing temperature spreadIncreased, and changed to three temperature cycle, makes within introduction real in introduced real spread increased of Foundation Shang for low temperature fire temperature of three temperature cycle until spread increased completed, so on can makes two sets introduction real once while joined, two species cycle Yiqi he Cheng, is equal to only do once PCR, and sensitivity and sets type II times PCR is, in we recently launched of PTc 51 air type DNA hot cycle instrument ShangYou can complete a full program. Success of the nested-PCR, PCR detection of the entire process can be completed within the 5h, making inspection report on the day a reality, making PCR detection in clinical reality based. Third, the combined PCR (Multiplex PCR) primers and method for amplification of DNA fragments are called composite pCR。 This method was initially detected by Chanberlain human genes evolved. Bej development in environmental samples with different case of a bacterial gene sequencing and PCR amplification of detection methods. Two different types of Legionella (Legionella) gene, a specific lung l gene (MIP), the other for L-5SRRNA gene through primer swing (staggered) add combined with PCR. The first MIP 7 primers PCR amplification cycles, then add the 38 5SrRNA primers PCR amplification cycles. LacB and adding a different amount of LacZ gene primers for PCR amplification and detection of Escherichia coli and human fecal pollution fineColiforms bacteria including E.coli bacteria, intestinal pathogenic salmonella and Shigella bacteria. In a compound in the PCR, all primed Ta value should be similar. If two pairs of primers Tq difference exceeding ± ° c 10%, will make significantly different amount of amplification products, one of the amplification product or for the purpose of DNA is difficult to observe. In addition, should also target DNA length that are similar, except large videosTarget DNA amplification of priority, therefore, will produce different output amplification product, to do this, using DNA amplification or join introduced does not equal amounts of swing method of solving. Four, reverse PCR (Reverse or Inverse PCR PCR) reverse side-the purpose of PCR amplification of a known sequence of DNA, which means that thisNot in between a pair of primers but a reaction system synthesis of DNA in animals. Inverse PCR can be used to research and connect to a known DNA segment for unknown chromosomal sequences, also known as the chromosomes move slow or chromosome walking. Core DNA primers and then select district two complementary sequences at the end, but the two Primer 3 ' ends are mutually inverse. Before amplification restrictionEndonuclease enzyme cuts DNA samples, and then connecting into a circular DNA molecule with DNA ligase, inverse PCR amplification primers piece of upstream and downstream segments; is now preparing a yeast artificial chromosome (YAC) linear DNA fragment of the hybridization probes, this transposon insertion sequence of gene bank for identification and identification of chromosome DNA fragment sequences on ten-Important. This method is the lack of: ① need to choose from the many enzymes restriction enzymes, or you must choose the appropriate enzymes for digestion in order to get a reasonable sized DNA fragments. This option cannot be non-enzyme cutting sites cut target DNA. ② most nuclear genome contains many moderate and highly repetitive sequence, of unknown function in the YAC, or Cosmid sequenceSometimes these sequences will be in the column, so that by inverse PCR is multiple gene sequences and probe could cross. After using unknown sequence reverse PCR amplification analysis, exploring the neighborhood known sequence of DNA fragments, and only know part of the molecular cloning of full length cDNA sequence, DNA probe of establishing full length. Applies to gene cross,Transfer factor and known sequence analysis of DNA flanking virus integration site research. Five, asymmetric PCR (Asymmetric PCR) fundamentals of asymmetric PCR is used is equivalent in a pair of primers to produce a large number of single-strand DNA (ss-DNA). Of both primers are called restrictive and non-restrictive approach; its the bestGeneral 1:50~1:100, the key is to limit the absolute amount of primer. Limiting primer-too much too little, is detrimental to the preparation ss-DNA. General preparation of target DNA double-stranded DNA PCR (ds-DNA), and then to ds-DNA as a template, with only one of the excessive preparation ss-DNA single primer PCR primers. DS-DNA and ss-DNA because of different molecular weight can be separated in electrophoresis, are pure ss-DNA. Preparation of asymmetric PCR is mainly sequence ss-DNA, particularly by cD-NA asymmetric PCR by DNA sequence analysis is the study of Eukaryotic DNA good way of Exon. Mark six, PCR (LP-PCR) and color PCRLP-PCR (Labelled Primers PCR) is the use of isotopes, such as fluorescein for PCR Primer 5 ' side marking, detection of target genes exist or not, and more intuitive compared to conventional PCR, eliminating the restriction endonuclease digestion and tedious steps such as hybridization, and a simultaneous analysis of multiple genetic components, Ideally suited for a large number of clinical specimens and genetic diagnosis.
This method works only for qualitative identification of PCR products. Color PCR (Colorcomplement assay) literal translation is "color complementary test", is a type of LP-PCR, color PCR paraphrase more clearly: it is marked with a fluorescent dye primer 5 ' end. Fluorescent dyesFAM and JOE green fluorescence; TAMRA fluorescent red; COUM is blue fluorescence. Different fluorescence labeling primers at the same time participate in the reaction, after amplification of target genes with primers, respectively 5 '-end of the dye, or centrifugal sedimentation by electrophoresis, the naked eye under different fluorescent color to determine whether the target gene and amplification of gene type. Usually takes only2 kinds of a different color primer, as genetic testing primer and another as the control condition in the control, diagnosis of chromosomal translocation gene is missing, or infected with a virus. When the detection of point mutations, more colors are available, such as point mutations of several suspicious virus infection, genetic disease, HLA loci analysis of color PCR can be used to test several sites. Seven,Plus-ended PCR plus-PCR (add-PCR) is to enable the amplification products by 5 '-end of the DNA sequencing of PCR. Design and ends when the PCR primers, among paired with the template part, plus a number of bases, thus the amplification product adds an extra at the end of a section of DNA, such as with a restriction enzyme recognition sequences or specific features of the DNAFragment. Stoflet reports plus structural gene of Bacteriophage T7 promoter and, of course, can be used to mark the end of the DNA fragment or the introduction of a specific point mutations. Additive bases at the end of the number and length of a primer about, when the amplification primers when long enough or even at the end of the product plus a dozen to dozens of bases. Eight, fixed or anchored PCR PCRAnchored PCR (AnchoredPCR,A-PCR) mainly used in analysis with variable DNA sequences at the end of, Loh A-PCR in human peripheral blood lymphocyte t-cell receptor alpha-chain mRNA analysis of variability. CDNA synthesis, and Deoxy-nucleotide transferase in at the end of its 3 '-end variable plus a pOlyG tail. Loh constant and variable region connecting parts such as a primer and one primer is a 5 ' Primer-polyG tail. A PolyG primer is a fixed point of the tail, which can be combined and PolyG tails, no matter how the sequence as the rest, only identify the fragment ends, using this method can be checked out from the foregoing mRNA toLess of 20 different series, each one is unique, that A-PCR results of any particular sequence is not tendentious, t-cells, tumors, and other parts can be used to study of antibody genes. PCR in polypropylene pipes, glass tablets can be of multiple plywood material for PCR, on microscope slides with tissue cell smears or slices of direct DNA amplificationPCR method is called the glass Tablet (Slide-PCR). First cell smears or is a single layer of cells, and then using methanol/acetic acid (3:1,V/V) and Carnoy solution and alcohol-free or fixed 5~15min 4% paraformaldehyde solution. Rinse with distilled water, drying, used directly or stored in the standby-20 ℃. On the glass slide 20mmX28mm for immunohistochemical reaction area. Joining the PCR reaction mixture 30 μ l, 10mmol/L TrispH8,3,50mmol/L KCl,1.5mmol/L MgCl2,200 Mu mol/l dNTPs,100nmol/L primer, 0.01% (V/V) StateAdhesive, 0.2%BSA,2.5u/100 μ l Taq enzyme. 22mmx40mm cover and cover glass slides, edge sealed with paraffin oil. PCR thermal cyclers slides into on the metal block, the metal contact with the sample maximum, as with polypropylene pipes, 30~40 a loop. For amplification of short fragments in later cyclesVariability in temperature can be reduced. After the reaction, cooled glass slide placed in chloroform to remove most of the mineral oil, but do not remove the cover glass, covered with a pointed tweezers gently twist up corner of the slide, in the corner of a relative in the PCR reaction mixture is the lunula surface, move liquid collector. General recycling mixture 25 μ l, products used for agarose electrophoresis or PCR primersStandard PCR amplification again.
On-chip amplification of displayed can be done in situ hybridization. Slide-PCR, 0.1%~1% BSA requirements. Join BSA amplification can guarantee results, but may not be very efficient. Gelatin (0.0001% at least), is very important to the target DNA amplification of 1kb. But small pieces of the amplification would not seriously affect the results。
Or fixation on Slide-PCR samples of different extraction methods are possible. Silde-PCR mechanism may be the starting part of the degeneration process of DNA from cells in the wash came, and then in the cells and slide water phase PCR. Using dig-labeled human whole genomic DNA probe hybridization DNA indicates that the starting the loop at very low levels,After 30 cycles is very rich.
Routine staining shows that only a small number of changes. On the Silde-PCR for the glassy cell sample provides a better way without enclosed on the samples from the slide down, easy to operate, pollution reduction. This negligible volume of original samples and history tracks you want to save (for example, cervical smear, or smear)Practical value. Ten, reverse transcription PCR method for detection of RNA RNA polymerase chain reaction (RT-PCR) is the RNA as a template, combined with reverse transcription reaction (reverse transcrip-tion, RT) PCR, can be used to detect a single cell or a few less than 10 copies of specific DNA in cells, forFacilitate detection of RNA viruses; and to receive complementary cDNA amplification of specific RNA provides an extremely beneficial and effective way. RNA Amplification consists of two steps: ①the single primer-mediated and reverse transcriptase enzyme catalysis, complementary RNA strand cDNA synthesis; ② cDNA and RNA chains dissociation after heating, and then with another primer annealingAnd catalyzed by DNA polymerase primer extension to generate double-stranded DNA of target, last target DNA amplification. Key step is reverse transcription of the RNA in the RT-PCR, cDNA PCR and PCR conditions. As the primer is highly selective, cell total RNA without grade separation, can be directly used for RNA PCR. But RT-PCR-RNA products demanding, as a template of RNA molecules must be complete and do not contain DNA, proteins, and other impurities. Even a very low concentration of DNA in the RNA, amplification occurs after non-specific amplification; protein is not subject to a net, and RNA-binding effect after RT and PCR; remnants of RNase a plywood RNA degradation.
Guanidine thiocyanate (GaSCN) or by-CsCl acid of Guanidine thiocyanate-phenol-chloroform can be formulated by RNA product of ideals, especially the latter method is preferred, for General Labs. Reverse transcription enzyme has two kinds of common, poultry into myeloid leukemia virus (Avianmyeloblastosis virus,MV) and Chamorro rat leukemia virus (Moloney murineleukemia virus, MO-MLV) reverse reverse transcriptase (RT). Mo-MLV-RT under more normal circumstances, but when a template of RNA secondary structures seriously affects the art, can use AMV-RT, which the most suitable temperature for 72° C, above Mo-MLV-RT of optimum temperature (37 ° c), and the response of higher temperature helps to eliminate the secondary structure of RNA. One-step amplification (one step amplification) is to detect low abundance mRNA expression, use the same buffer, in the same system include reverse transcriptase enzymes, primers, TaqEnzymes, 4 kinds of dNTP direct mRNA RT and PCR amplification. Taq enzyme found not only have the function of DNA polymerase and reverse transcriptase activity, in its dual role in the same system can be used directly as mRNA as a template for reverse transcription and subsequent PCR amplification, so that mRNA PCR procedures more simplified, the required sample amountLess to a minimum, clinical testing very beneficial for small samples. One step total RNA Amplification to detect small and medium to low abundance mRNA 1NG. This method can also be used for construction of cDNA library of low abundance mRNA and cloning of specific cD-NA and possible combination and sequencing of the Taq enzyme technology, Auto-reverse, gene amplification and gene transcriptionSequencing in a test tube. Following the, quantitative PCR 1. DNA-PCR isotope labeled probes with electrophoresis for quantitative PCR amplification products after crossing under autoradiography film after exposure intensity can be made to the template DNA quantitative. Abbot, use this method on quantitative reverse transcriptase gene in human t-cell leukemiaResearch. PCR amplification product designed specifically to detect ds-DNA of micro-fluorescence quantitative meter, using dye-H33258 combined with double-stranded DNA by fluorescence enhancement characteristics of 50 times.
Standard template series from dilution curve amplification products or the amount of template DNA in the samples are read on copy number, achieve the purpose of quantitative PCR. Than doubling dilutionFor serial dilution of PCR template, find the minimum (PCR-EB) comparison of detection limit, semi-quantitative PCR method is also commonly used. 2. MRNA-PCR quantitative quantitative requires two enzymes due to MRNA-PCR (RT and Taq) catalysis, thus affecting factors are. In 1989 Wang reported low abundance mRNA, such as absolute quantitative method。 Concentration of a known and mR-NA: a sequence within the same test target mRNA (fragment length in different, easy separation of PCR products after amplification), within the same system, same by measuring mRNA with 32P labeled primers for reverse transcription and PCR amplification, PCR products after gel electrophoresis, determination of activity of both products separately, by advancePreparation of the standard curve calculated that each sample of specific mRNA. Gilliland, results show that 1NG 1PG total RNA-specific mRNA quantitative.
The quantitative methods in cancer, metabolic disorders, are important in the study of gene expression regulation. For example, suppose we want to study on both ends of the DNA double-stranded sequenceColumns are: TATTCGGGCTTTCCAAGCAACTAG........... GATCTATCCAACGGCTAGGCATTTATAAGCCCGAAAGGTTCGTTGATC........... CTAGATAGGTTGCCGATCCGTAAA prior to PCR, we synthesize two 20-30 first base primers, respectively, paired with an upper and lower one end of the chain, such as is (as the template can distinguish between, in lowercase): ataagcccgaaaggttcgtt, other one is tttacggatcggcaacctat. These twoAnd templates for DNA, DNA polymerase, and substrate (the four deoxyribonucleoside) mixed together, we can begin to make PCR.
The first step is called "degeneration", a sample is heated to 94-96 ° c for a few minutes, denatured into single DNA template strand. The second step called "annealing", let the temperature of the sample down to 50-65 ° c for a few minutes, primerIncorporated into a template. TATTCGGGCTTTCCAAGCAACTAG........... GATCTATCCAACGGCTAGGCATTTataagcccgaaaggttcgtttatccaacggctaggcatttATAAGCCCGAAAGGTTCGTTGATC...........
CTAGATAGGTTGCCGATCCGTAAA step called "extension" sample temperature up to 72 ° c to minutes, DNA polymerase can start from primers used copies by the end of the new chain. TATTCGGGCTTTCCAAGCAACTAG........... GATCTATCCAACGGCTAGGCATTTataagcccgaaaggttcgttGATC........... CTAGATAGGTTGCCGATCCGTAAATATTCGGGCTTTCCAAGCAACTAG........... GATCtatccaacggctaggcatttATAAGCCCGAAAGGTTCGTTGATC........... CTAGATAGGTTGCCGATCCGTAAA after a three-step cycle, a double strand into two, and then to aA loop, into four sth On a computer-controlled circulation heaters after 30 cycles, accurate amplification of the original sample of 30 power of 2 times, and it only takes two or three hours. PCR is to succeed, there must be able to endure high temperatures, at high temperatures can still have activity of DNA polymerase. This enzyme from living in hot springs bacteriaExtract, one of the most common of which is called Taq polymerase. Poor Taq polymerase fidelity of wild-type, long copy template is prone to mutation. Through genetic engineering, we have access to a high-fidelity of Taq polymerase, greatly improving the PCR replication degree of precision. Applications in molecular biology research, PCR is widelyMade in gene cloning and mutation. On the clinical medicine, PCR was used to identify genetic diseases and rapid detection of viruses, germs, infection. Using traditional methods, to detect viruses, germs, infection requires several weeks to identify pathogens training, and now using PCR, you can quickly determine the cells (blood cells) for viruses, germs, DNA (As the HIV DNA) and confirmed. On the forensic, PCR has found evidence of important methods. For example, 0.1 liters of saliva contained traces of DNA can be amplified by PCR and DNA sequencing and identification of adequate criminal. Hair, blood, saliva, semen can be important evidence. Using PCR techniques, scientistsFrom Lincoln's hair and blood, Egypt 80 million years ago in the Mummy, amber insects, dinosaur bones, and other unusual extract enough DNA samples for research. Museum of fossil specimens are likely to become the subject of genetics, birth of a molecular Paleontology.
Others:
